Instructions to use HuggingFaceBio/Carbon-500M-GGUF with libraries, inference providers, notebooks, and local apps. Follow these links to get started.
- Libraries
- llama-cpp-python
How to use HuggingFaceBio/Carbon-500M-GGUF with llama-cpp-python:
# !pip install llama-cpp-python from llama_cpp import Llama llm = Llama.from_pretrained( repo_id="HuggingFaceBio/Carbon-500M-GGUF", filename="carbon-500m-bf16.gguf", )
output = llm( "Once upon a time,", max_tokens=512, echo=True ) print(output)
- Notebooks
- Google Colab
- Kaggle
- Local Apps Settings
- llama.cpp
How to use HuggingFaceBio/Carbon-500M-GGUF with llama.cpp:
Install (macOS, Linux)
curl -LsSf https://llama.app/install.sh | sh # Start a local OpenAI-compatible server with a web UI: llama serve -hf HuggingFaceBio/Carbon-500M-GGUF:Q4_K_M # Run inference directly in the terminal: llama cli -hf HuggingFaceBio/Carbon-500M-GGUF:Q4_K_M
Install from WinGet (Windows)
winget install llama.cpp # Start a local OpenAI-compatible server with a web UI: llama serve -hf HuggingFaceBio/Carbon-500M-GGUF:Q4_K_M # Run inference directly in the terminal: llama cli -hf HuggingFaceBio/Carbon-500M-GGUF:Q4_K_M
Use pre-built binary
# Download pre-built binary from: # https://github.com/ggerganov/llama.cpp/releases # Start a local OpenAI-compatible server with a web UI: ./llama-server -hf HuggingFaceBio/Carbon-500M-GGUF:Q4_K_M # Run inference directly in the terminal: ./llama-cli -hf HuggingFaceBio/Carbon-500M-GGUF:Q4_K_M
Build from source code
git clone https://github.com/ggerganov/llama.cpp.git cd llama.cpp cmake -B build cmake --build build -j --target llama-server llama-cli # Start a local OpenAI-compatible server with a web UI: ./build/bin/llama-server -hf HuggingFaceBio/Carbon-500M-GGUF:Q4_K_M # Run inference directly in the terminal: ./build/bin/llama-cli -hf HuggingFaceBio/Carbon-500M-GGUF:Q4_K_M
Use Docker
docker model run hf.co/HuggingFaceBio/Carbon-500M-GGUF:Q4_K_M
- LM Studio
- Jan
- Ollama
How to use HuggingFaceBio/Carbon-500M-GGUF with Ollama:
ollama run hf.co/HuggingFaceBio/Carbon-500M-GGUF:Q4_K_M
- Unsloth Studio
How to use HuggingFaceBio/Carbon-500M-GGUF with Unsloth Studio:
Install Unsloth Studio (macOS, Linux, WSL)
curl -fsSL https://unsloth.ai/install.sh | sh # Run unsloth studio unsloth studio -H 0.0.0.0 -p 8888 # Then open http://localhost:8888 in your browser # Search for HuggingFaceBio/Carbon-500M-GGUF to start chatting
Install Unsloth Studio (Windows)
irm https://unsloth.ai/install.ps1 | iex # Run unsloth studio unsloth studio -H 0.0.0.0 -p 8888 # Then open http://localhost:8888 in your browser # Search for HuggingFaceBio/Carbon-500M-GGUF to start chatting
Using HuggingFace Spaces for Unsloth
# No setup required # Open https://huggingface.co/spaces/unsloth/studio in your browser # Search for HuggingFaceBio/Carbon-500M-GGUF to start chatting
- Atomic Chat new
- Docker Model Runner
How to use HuggingFaceBio/Carbon-500M-GGUF with Docker Model Runner:
docker model run hf.co/HuggingFaceBio/Carbon-500M-GGUF:Q4_K_M
- Lemonade
How to use HuggingFaceBio/Carbon-500M-GGUF with Lemonade:
Pull the model
# Download Lemonade from https://lemonade-server.ai/ lemonade pull HuggingFaceBio/Carbon-500M-GGUF:Q4_K_M
Run and chat with the model
lemonade run user.Carbon-500M-GGUF-Q4_K_M
List all available models
lemonade list
Carbon-500M GGUF
Running with llama.cpp
Carbon is a base DNA model (not instruction-tuned). Use the raw completion front-end so llama.cpp does not apply any chat templating:
llama-completion \
-hf HuggingFaceBio/Carbon-500M-GGUF:Q8_0 \
--prompt "<dna>ATGCGCTAGCTACGATCGATCGTAGCTAGCTAGCTAGCTACG" \
-n 128 --temp 0 --no-display-prompt
If you use llama-cli instead, pass -no-cnv so it does not wrap the prompt
in assistant-style markers (otherwise the model may emit annotation tags such
as <protein_coding_region> instead of DNA).
Available files
| Quant | File | Size |
|---|---|---|
| BF16 | carbon-500m-bf16.gguf |
982.2 MB |
| Q8_0 | carbon-500m-q8_0.gguf |
524.6 MB |
| Q6_K | carbon-500m-q6_k.gguf |
443.2 MB |
| Q5_K_M | carbon-500m-q5_k_m.gguf |
405.1 MB |
| Q4_K_M | carbon-500m-q4_k_m.gguf |
369.2 MB |
K-quants are produced with --token-embedding-type Q8_0 --output-tensor-type Q8_0
so the sensitive embedding/output tensors stay at Q8_0 precision (important for
this model's tight DNA-vs-text logit margins).
Requires a recent llama.cpp
HybridDNATokenizer support was merged in ggml-org/llama.cpp#23410, so any build from master after that works:
git clone https://github.com/ggml-org/llama.cpp
cd llama.cpp && cmake -B build && cmake --build build -j
Usage
Download
hf download HuggingFaceBio/Carbon-500M-GGUF carbon-500m-bf16.gguf --local-dir .
Basic DNA completion
./build/bin/llama-completion -m carbon-500m-bf16.gguf \
-p '<dna>ATGCGCTAGCTACGATCGATCGTAGCTAGCTAGCTAGCTACG' \
-n 64 --temp 0 -no-cnv
As a draft model for speculative decoding
Carbon-500M shares the HybridDNA vocab with the larger models, so it makes an excellent draft model:
# 8B target + 500M draft -> ~2x speedup at temp=0
./build/bin/llama-speculative \
-m carbon-8b-bf16.gguf \
-md carbon-500m-bf16.gguf \
-p '<dna>ATGCGCTAGCTACGATCGATCGTAGCTAGCTAGCTAGCTACG' \
-n 256 --temp 0
See also
- Source weights: HuggingFaceBio/Carbon-500M
- Other GGUF variants: 500M · 3B · 8B
License
Apache-2.0, inherited from the source model.
- Downloads last month
- 285
4-bit
5-bit
6-bit
8-bit
16-bit
Model tree for HuggingFaceBio/Carbon-500M-GGUF
Base model
HuggingFaceBio/Carbon-500M